This is an observational study using a prospective cohort, designed for the investigation of the differences in mRNA expression of fibulin-1, elastin, MMP-1, bFGF, and α-SMA between the ventral and dorsal tunica dartos in patients with hypospadias and chordee. The protocol is prepared according to the SPIRIT (Standard Protocol Items: Recommendations for Interventional Trials) 2013 checklist for reporting a protocol study [
This study was conducted in accordance with the principles outlined in the Declaration of Helsinki. The approval for the protocol of this study was granted by the Medical Research Ethics Committee, Universitas Indonesia, in April 2022 (KET-413/UN2.F1/ETIK/PPM.00.02/2022). All participants provided written informed consent prior to their inclusion in the study, and the study protocol was reviewed and approved by the institutional review board to ensure ethical standards and participant safety.
Informed consent was obtained from all participants during the primary data collection phase. The original informed consent covered the possibility of secondary data analysis, and the institutional review board confirmed that no additional consent was required for this study’s secondary analysis.
To ensure the privacy and confidentiality of participants, all study data were deidentified prior to analysis. Personal identifiers were removed, and the data were anonymized to protect the participants’ identities. Appropriate measures were taken to maintain the confidentiality of the data throughout the study.
No additional compensation was provided for this analysis as it did not involve additional participant interaction.
There are no images included in the manuscript or supplementary material that could potentially identify individual participants. If such images are deemed necessary in future submissions, we will ensure that consent has been obtained from identifiable individuals, and relevant consent forms will be uploaded during resubmission.
Consent for the data collection and publication has been obtained from the parents of patients with hypospadias. The consent was sought after the parents and their children have already received an explanation from the main researcher.
The data taken for this study were stored and uploaded over the internet without any identifier.
The eligibility criteria for participants in this study are as follows:
Inclusion criteria:
Diagnosed as having hypospadias with chordee by a pediatric urologist
Aged 6-18 months
Planned to undergo urethroplasty
Exclusion criteria:
The amount of available tissue specimens is insufficient for further examination
Patients with genital ambiguity characterized by clitoral hypertrophy
The patient is experiencing an infection of the prepuce
Patients with a history of previous chordectomy or urethroplasty surgery
Patients with conditions that can experience dysregulation of extracellular matrix component proteins, namely malignancy and Marfan syndrome
Participants for this research will be enrolled through a consecutive recruitment method. Parents of eligible patients will receive information about the study’s procedures and will be given the opportunity to decide whether they wish for their children to take part in the study during its duration.
The clinical outcomes measured in this study are as follows:
Expression of fibulin-1 mRNA
Expression of elastin mRNA
Expression of MMP-1 mRNA
Expression of bFGF mRNA
Expression of α-SMA mRNA
The clinical outcomes will be measured from differences in mRNA expression from both the dorsal and ventral aspects of the tunica dartos excised during urethroplasty. A positive control gene for both dorsal and ventral tissues will also be measured in subsequent analyses. The expression levels of the 5 genes will be assessed relative to the housekeeping gene β-actin using fold change values.
This study is single blinded. The laboratory assistant does not know which aspect of the penis that the specimen belongs to.
In this study, tissue samples from the dorsal and ventral sides of the tunica dartos will be obtained from patients with hypospadias and chordee. Ventral tunica dartos samples will be taken from each patient by the researcher as the performing operator, ensuring that the size and location of collection are standardized across all patients. The collected portions are shown in
Site of tissue sample collection from the dorsal and ventral sides of the tunica dartos from patients with hypospadias and chordee, from an observational study conducted in Arifin Achmad General Hospital Riau in 2023 (source: personal documentation of the researcher).
RNA will be isolated from all samples using the RNeasy Mini Kit (Qiagen) following the kit’s manual instructions. Initially, β-mercaptoethanol and ethanol are added to Buffer RPE. Tissue samples are separated from RNAlater stabilization and then mixed with Buffer RLT. For tissue weighing 20-30 mg, 600 µL of Buffer RLT is added. Sample disruption and homogenization are performed using an ultrasonic disruptor tool for 20-40 seconds. The lysed samples are centrifuged at 17,000×g for 3 minutes, and the supernatant is collected for RNA extraction. Then, 70% ethanol, equal to 1× the lysate volume, is added and homogenized using a micropipette.
A total of 700 µL of the sample is transferred to a QIAamp spin column placed in a 2-mL collection tube and centrifuged at >8000×g for 1 minute. The supernatant is discarded, and the process is repeated by pairing a new 2-mL collection tube with the QIAamp spin column until all lysates, including precipitates, are processed. The supernatant and 2-mL collection tube are discarded. The QIAamp spin column is then transferred to a new 2-mL collection tube.
Buffer RW1 (700 µL) is added to the QIAamp spin column and centrifuged at >8000×g for 1 minute. The supernatant and 2-mL collection tube are discarded. This step is repeated with the addition of 500 µL of Buffer RPE. The QIAamp spin column is then combined with 500 µL of Buffer RPE and centrifuged at 17,000×g for 3 minutes, and the supernatant is transferred to a new 2-mL tube and centrifuged at 17,000×g for 1 minute. The QIAamp spin column is moved to a new 1.5-mL microcentrifuge tube, and 30-50 µL of RNase-free water is added directly to the QIAamp membrane, followed by centrifugation at >8000×g for 1 minute.
The quantification stage serves to determine the RNA concentration in each sample in order to dilute them to the same concentration, which is 0.2 ng/µL. RNA quantification from each sample and control will be performed using the Qubit dsDNA HS kit (Q32851; Thermo Fisher Scientific). All samples from the whole genome amplification stage are vortexed and diluted by mixing 5 µL of the sample with 45 µL of double-distilled water to achieve a 1:10 dilution. Samples, controls, and the Qubit standard solution are placed in 500-µL tubes containing Qubit dsDNA reagent with specific volumes.
All samples are then vortexed, spun down, and incubated at room temperature for 2 minutes. The RNA quantification results are then used for circular DNA synthesis using the cDNA Taqman MicroRNA Reverse Transcription Kit (4366596; Thermo Fisher Scientific). The composition of the reagents used can be seen in Hidayati et al [
A real-time quantitative reverse transcription–polymerase chain reaction (qRT-PCR) machine will be used to perform the qRT-PCR amplification using the primary sequences in
The machine monitors fluorescence levels after each PCR cycle to track the amount of amplified DNA in real time.
Primary sequences of the genes used in the study.
| Gene | Nucleotide code | Primary sequence (5’-3’) |
| Fibulin-1 | NM_006486.3 |
Fa: GATGGTGTCTCCTGTGAAGATG Rb: TGATGCATGTATGCCCGATAG |
| Elastin | NM_000501.4 |
F: CTGCAAAGGCAGCCAAATAC R: CACCAGGAACTAACCCAAACT |
| MMP-1c | NM_002421.4 |
F: GCCTTCCAACTCTGGAGTAATG R: GAATGGGAGAGTCCAAGAGAATG |
| bFGFd | NM_001361665.2 |
F: TGAAACGAACTGGGCAGTATAA R: TTGACCTGACTGTGGAAGAAC |
| αSMAe | NM_001613.4 |
F: GACCCTGAAGTACCCGATAGA R: CTCAGCAGTAGTAACGAAGGAATAG |
aF: forward.
bR: reverse.
cMMP-1: matrix metalloproteinase-1.
dbFGF: basic fibroblast growth factor.
eα-SMA: α-smooth muscle actin.
The amplification curve data will then be analyzed to determine the cycle threshold (Ct) value. The Ct values are then normalized to that of the housekeeping gene to calculate the relative gene expression using the ΔΔCt method.
The data to be collected in this study include clinical characteristics such as age, height, weight, BMI, comorbidities, and delivery history, accompanied by mRNA expression from both the dorsal and ventral sides of the tunica dartos tissue.
All quantitative data obtained from this research will be analyzed using SPSS (version 25.0; IBM Corp) software. The normality of all numeric data will be tested using the Kolmogorov-Smirnov test. Numeric data will be presented as mean (SD) for normally distributed data and median (range) for nonnormally distributed data.
If the obtained data are normally distributed, an independent 2-tailed