This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work, first published in JMIR Research Protocols, is properly cited. The complete bibliographic information, a link to the original publication on http://www.researchprotocols.org, as well as this copyright and license information must be included.
The Internet has successfully been used for patient-oriented survey research. Internet-based translational research may also be possible.
Our aim was to study the feasibility of collecting biospecimens from CCFA Partners, an Internet-based inflammatory bowel disease (IBD) cohort.
From August 20, 2013, to January 4, 2014, we randomly sampled 412 participants, plus 179 from a prior validation study, and invited them to contribute a biospecimen. Participants were randomized to type (blood, saliva), incentive (none, US $20, or US $50), and collection method for blood. The first 82 contributors were also invited to contribute stool. We used descriptive statistics and t tests for comparisons.
Of the 591 participants, 239 (40.4%) indicated interest and 171 (28.9%) contributed a biospecimen. Validation study participants were more likely to contribute than randomly selected participants (44% versus 23%,
Participants are willing to contribute and it is feasible to collect biospecimens from an Internet-based IBD cohort. Home saliva kits yielded the highest return rate, though mobile phlebotomy was also effective. All samples were sufficient for genetic testing. These data support the feasibility of developing a centralized collection of biospecimens from this cohort to facilitate IBD translational studies.
Inflammatory bowel disease (IBD), including Crohn’s disease (CD) and ulcerative colitis (UC), affects 1.1-1.4 million individuals in the United States and is increasing in prevalence [
Despite this emerging knowledge, little is known about how these factors impact disease risk [
Although case-control studies have historically been used for gene-environment studies, prospective cohort studies have many advantages, including the ability to study multiple outcomes [
CCFA Partners is an Internet-based cohort of over 13,000 adults with IBD that was developed in 2011 to accelerate clinical and patient-reported outcomes research [
Here, we report the feasibility of collecting saliva, blood, and stool from members of the CCFA Partners cohort in a systematic fashion for use in future studies. If feasible, this collection could provide a tremendous resource for IBD research and serve as a model for future methods of Internet-based translational research.
Methods for recruitment and prospective follow-up of participants in CCFA Partners have been previously described [
Our study was designed to collect and analyze approximately 100 blood samples (50 by mobile phlebotomist and 50 drawn through physician offices) and 100 saliva samples. A total of 179 CCFA Partners participants who previously participated in a validation study [
In addition to the validation cohort, we also randomized all CCFA Partners participants (“General CCFA Partners population”) taking any survey between August 20, 2013, and January 4, 2014, according to the same study arms. Within each arm, participants were successively invited until the recruitment target was approached.
Consent forms described the purpose, potential impact, and potential risks of genetic studies on biospecimens, as well as privacy protections including de-identification of samples, physical lock-and-key of stored specimens, and encryption of all data. Consenting participants were mailed a biospecimen collection kit either to be sent back to the Biospecimen Processing Facility or contacted by the mobile phlebotomy service to schedule a time and location for blood draw, as applicable.
Our study was designed to collect 50 stool samples among participants who provided genetic specimens. To achieve this, the first 82 participants who submitted a blood or saliva specimen were then invited to contribute a one-time stool sample. Participants were compensated US $20 for stool samples, regardless of whether they had been randomly assigned an incentive for the initial biospecimen.
For the mobile phlebotomy arm, we used Examination Management Services, Inc. (EMSI), a nationwide mobile specimen collection service. EMSI contacted participants to schedule a blood draw at a convenient time, and phlebotomists mailed blood samples directly to the Biospecimen Processing Facility per EMSI protocol. For the physician blood draw arm, we mailed each participant a kit containing blood draw supplies and a prepaid FedEx return label for overnight delivery. For the saliva collection arm, we mailed participants Oragene
DNA was extracted from saliva samples using the Chemagic Magnetic Separation Module I (MSMI) robotic system (Perkin Elmer), using the Chemagic DNA Saliva Kit and the MSMI 24-rod head. The MSMI system isolated DNA after cell lysis via highly specific binding of the DNA to proprietary M-PVA magnetic beads. Once bound, the DNA was washed several times and then released from the magnetic beads. Optical density readings were taken on a Nanodrop to assess the 260/280 and 260/230 ratio quality metrics. DNA quantitation was assessed via Picogreen using the Quant-iT PicoGreen dsDNA Assay Kit cat# P7589 (Life Technologies). DNA was extracted from blood using Puregene high salt extraction chemistry on the AutopureLS DNA extraction robotic system. DNA quantitation and 260/280 and 260/230 ratio quality metrics were performed on a Nanodrop spectrophotometer.
Saliva and blood samples were genotyped for 14 IBD-associated single nucleotide polymorphisms (SNPs) using TaqMan SNP Genotyping Assays from Life Technologies. We used pre-designed assays for all but one SNP (rs2066847), for which a custom primer was designed using previously established sequences (Forward primer: GTCCAATAACTGCATCACCTACCT; Reverse primer: CAGACTTCCAGGATGGTGTCATTC Probe 1 - VIC-MGB; Dye: CAGGCCCCTTGAAAG Probe 2 - FAM-MGB; Dye: CAGGCCCTTGAAAG) [
Samples were aliquotted into cryovials and stored at -80 °C until the time of extraction. Bacterial DNA was extracted from 30-60 mg (solid) or 100-150 mg (liquid) of frozen fecal material as previously described [
We used descriptive statistics and
Of the 591 cohort member invited to contribute a biospecimen, 239 (40.4%) participants indicated interest and 171 (28.9%) contributed a biospecimen. In total, we collected 90 saliva samples, 47 blood samples from the mobile phlebotomy service, and 34 blood samples through physician offices. Demographic information for general CCFA Partners population included in this study and validated population participants is shown in
Study population characteristics stratified by random selection versus selection from prior validation study participants and by biospecimen contribution status.
|
Selection status | General CCFA Partners population | Validated population | ||||||
CCFA Partners general population |
Validated population (n=179) | Contributed |
Did not contributea
|
|
Contributed |
Did not contributea
|
|
||
Female, % | 71.4 | 73.2 | 73 | 70.8 | .67 | 74 | 72.2 | .74 | |
Age in years, mean | 45.1 | 46.6 | 46.9 | 44.6 | .49 | 48.2 | 45.4 | .60 | |
|
.54 |
|
|
.62 | |||||
|
White | 365 (94.8) | 156 (94.5) | 81 (94) | 285 (95.0) |
|
68 (96) | 88 (93.6) |
|
|
Black/African American | 8 (2.0) | 4 (2.4) | 1 (1) | 7 (2.3) | 1 (1) | 3 (3.2) | ||
|
Asian | 1 (<1.0) | 1 (<1.0) | 0 (0) | 1 (<1.0) | 0 (0) | 1 (1.0) | ||
|
Other | 11 (2.9) | 4 (2.4) | 4 (5) | 7 (2.3) | 2 (3) | 2 (2.1) | ||
|
.82 |
|
|
.04 | |||||
|
12th grade or less | 24 (6.0) | 4 (2.4) | 4 (4) | 20 (6.5) |
|
0 (0) | 4 (4.2) |
|
|
Some college | 101 (25.6) | 30 (18.0) | 21 (24) | 80 (26.1) | 11 (15) | 19 (19.8) | ||
|
College | 162 (41.0) | 73 (43.7) | 39 (44) | 123 (40.1) | 28 (39) | 45 (46.9) | ||
|
Graduate school | 108 (28.0) | 60 (35.9) | 25 (28) | 84 (27.4) | 32 (45) | 28 (29.2) | ||
|
.73 |
|
|
.14 | |||||
|
CD | 254 (61.7) | 94 (52.5) | 59 (63) | 196 (61.4) |
|
46 (59) | 48 (47.5) |
|
|
UC/IC | 157 (38.1) | 84 (46.9) | 34 (37) | 123 (38.6) | 32 (41) | 52 (51.5) | ||
Disease duration in years, median | 11.4 | 11.3 | 13 | 11.1 | 13 | 10.0 |
aIncludes participants who did not indicate interest and participants who indicated interest but never submitted a biospecimen.
Overall, age, sex, race, disease type, or duration were not related to contribution status. Participants from the validated population were twice as likely to submit a biospecimen than general CCFA Partners population: 43.6% versus 22.6% (78/179 versus 93/412, respectively),
A total of 171 participants contributed blood or saliva. Four additional participants attempted to contribute, but for process reasons these were not obtained or biospecimen type was switched, so they were excluded from return rate analysis. Among biospecimen types, the return rate for saliva was higher than blood collected by mobile phlebotomist and at the doctor’s office (38%, 31%, and 17% respectively,
Return rates for each method and level of incentive were stratified by sex, prior participation in validation study, and race and education level as a proxy for socioeconomic status. An effect of incentives for saliva was observed in males, with 23% return rate for no incentive (5/22), 47% (9/19) for $20, and 58% (15/26) for $50 (
Proportions of biospecimens returned by collection method and level of incentive.
A total of 171 samples were received (90 saliva, 81 blood). For saliva, total DNA yield ranged from 2.13-158.12 ug (median 52 ug) and 87% (81/93) of the samples yielded >20 ug. For blood, total DNA yield ranged from 6.59-382.14 ug (median 159 ug), 94% (76/81) of the samples yielded >50 ug, and 83% (67/81) yielded >100 ug. All samples were genotyped for 14 single nucleotide polymorphisms (SNPs) associated with IBD and risk allele frequencies (RAFs) were calculated. For all SNPs, the RAFs observed in our population were comparable to those in other large IBD populations [
Risk allele frequencies for SNPs in the CCFA Partners cohort compared to other large IBD populations.
SNP | Notable genes | RAF | Referencea |
rs12994997 | ATG16L1 | 0.58 | 0.52 |
rs6426833 |
|
0.56 | 0.54 |
rs6017342 | ADA,HNF4A | 0.52 | 0.53 |
rs11209026 | IL23R,IL12RB2 | 0.98 | 0.93 |
rs3024505 | IL10,IL20,IL19,IL24; PIGR,MAPKAPK2; FAIM3,RASSF5 | 0.15 | 0.16 |
rs10761659 |
|
0.62 | 0.54 |
rs2155219 |
|
0.52 | 0.51 |
rs1893217 |
|
0.18 | 0.16 |
rs2413583 | ATF4,TAB1, APOBEC3G | 0.89 | 0.83 |
rs11564258 | LRRK2,MUC19 | 0.03 | 0.03 |
rs2066844 | NOD2 | 0.05 | 0.07b |
rs2066845 | NOD2 | 0.05 | 0.02b |
rs2066847 | NOD2 | 0.05 | 0.02 |
aRAF values obtained from [
bRAF values obtained from [
A total of 49 stool samples were received. Of these, 18% (9/49) were liquid stool. Total bacterial content ranged from 6.04x102 to 4.97 × 106 16S sequences/mg stool, as shown in
Bacterial content of stool samples.
|
Total bacteria, 16S sequences/mg stool |
Minimum | 604 |
25% percentile | 111,400 |
Median | 436,000 |
75% percentile | 683,500 |
Maximum | 4,970,000 |
Mean | 557,554 |
Standard deviation | 754,369 |
Standard error of mean | 107,767 |
Lower 95% CI of mean | 340,874 |
Upper 95% CI of mean | 774,234 |
These data show that participants from an Internet-based IBD cohort are willing to contribute, and it is feasible to collect, biospecimens in a centralized fashion for use in translational research. The highest return rates were obtained from home saliva kits, though a mobile phlebotomy service was also effective for collecting blood samples. Among study participants who contributed blood or saliva, stool collection is also feasible. All biospecimens collected provided sufficient quantity and quality of material for genetic or microbiological analysis. As over 6000 CCFA Partners participants complete 1 or more surveys each year, we estimate that, if taken to scale, the cohort could collect >1800 biospecimens with a 1-year period. Taken together, these findings suggest that the CCFA Partners cohort is a valuable resource for future translational research studies.
CCFA Partners participants who previously participated in a study to validate IBD diagnosis [
Our previous survey-based study of biobanking attitudes found that 39% of the surveyed cohort would “definitely” donate and 56% would “probably” donate biospecimens for research [
Our return rates for saliva were significantly higher than for blood or stool. A number of reasons could contribute to this finding. First, there may be a lower perceived burden of collecting saliva than blood or stool because it is self-collected, can be done at home, can be collected immediately, is not painful, and manipulation of saliva may seem cleaner, more hygienic, or more comfortable than the other options. Indeed, in our previous survey of perceptions of biospecimen collection, sample type preference favored saliva over blood or stool (94% versus 90% and 77%, respectively). As not all patients undergo routine bloodwork, this may explain the lower rates of DNA collection in the doctor’s office blood draw arm, as compared to the other arms.
The authors are unaware of any other publications on feasibility of collecting biospecimens from entirely Internet-based prospective cohort studies such as CCFA Partners; however, there is one cross-sectional Internet-based study of the feasibility of collecting both survey-based and biospecimen data in an elderly Welsh population [
Our previous study on willingness to contribute biospecimens did not find that incentives were a reported motivator for participants [
In all, monetary incentives at the highest price point may be a motivating factor for contributing biospecimens in the CCFA Partners cohort. Other patient-level factors such as demographics, chronic disease state, trust, and intrinsic motivation may play a more important role. For future studies, the cost-effectiveness of incentives should be weighed against perceived motivation within a specific population.
Across all modalities of biospecimen collection (home collection kits for saliva, mobile phlebotomy and doctor’s office kits for blood), we were able to obtain sufficient quantity and quality of genetic material for genetic analysis. Additionally, the SNP genotyping results show that the CCFA Partners population is representative of a large number of loci of interest in IBD research. These findings replicate previously established risk allele frequencies and known SNP associations, further supporting the utility of the CCFA Partners cohort for future genetic and translational studies. Stool samples in both solid and liquid form were sufficient for quantification of bacterial DNA and likely would be useful for microbiological and environmental studies of IBD.
CCFA Partners has many strengths including the large size, prospective design, and entirely Internet-based platform, which allows for the largest known sample size for collecting patient-reported data in IBD. The prospective design also allows us to link patient-reported data, biospecimens, and biospecimen-derived data to future outcomes. Strengths specific to this biospecimen feasibility study include randomization across multiple strata including biospecimen type and incentive level and inclusion of all participants regardless of age or geographic location. Although we did target cohort members who previously participated in a study to validate IBD diagnosis, and therefore are more likely to be engaged and participate in this study, we analyzed return rates separately to eliminate selection bias. This group has now provided us with a repository of genetic and microbiological material in addition to detailed physician-validated information about their disease diagnosis, phenotype, and surgical history, which could be used for a variety of future translational research studies.
One limitation of this study is the relatively small sample size; however, this project was intended as a pilot and feasibility study. Nevertheless, there remains a possibility that larger numbers and greater statistical power would unmask other patterns in return rates, including differences by age, sex, race, disease type or disease duration, and the effect of incentives. While only four contributed biospecimens could not be obtained due to process factors (representing 1% of the sample size), this could represent a significant number or cost if biospecimens were to be collected on a much larger scale. By design, we attempted stool collection only among patients who provided genetic samples. While this allowed us to most efficiently estimate the proportion of participants who would provide both genetic and stool samples (an increasingly important aspect of translational IBD research), it did not allow estimation of the proportion of participants that would provide stool samples alone. Last, although CCFA Partners is a large IBD cohort and diagnoses have been validated [
In conclusion, the successful collection and analysis of biospecimens from the CCFA Partners Internet-based cohort represents a tremendous opportunity for a wide scope of IBD research, including genetic, molecular, microbiological, epidemiological, clinical, and outcomes studies. Platforms such as CCFA Partners may provide important opportunities to translate basic science knowledge into clinically useful information, leading the way
toward precision medicine.
Supplementary tables.
Total bacterial content of stool samples in the CCFA Partners cohort.
Crohn’s and Colitis Foundation of America
Crohn’s disease
deoxyribonucleic acid
Examination Management Services
inflammatory bowel diseases
polymerase chain reaction
risk allele frequency
single nucleotide polymorphism
ulcerative colitis
This work was supported in part by an investigator-initiated grant from GlaxoSmithKline, funding from the Crohn’s and Colitis Foundation of America, and a grant from the National Institutes of Health P30 DK034987.
RLR was involved with study concept and design, analysis and interpretation of data, drafting, and critical revision of the manuscript. ASG was involved with study concept and design, data acquisition and analysis, and critical revision of the manuscript. SFC was involved with study concept and design and critical revision of the manuscript. CFM was involved with study concept and design, statistical analysis and interpretation of data, and critical revision of the manuscript. WC was involved with computer programming and data acquisition and analysis. ELJ provided help with data acquisition and participant support for CCFA Partners. AAS collected and analyzed data. PB, HD, JL, and MG were involved with data collection, analysis, and critical revision of the manuscript. RSS was involved in study concept, critical revision of the manuscript, and study supervision and is the principal investigator of CCFA Partners. MDK was involved in all aspects of the study, including study concept and design, analysis and interpretation of data, critical revision of the manuscript, and study supervision.
MDK is a consultant to GlaxoSmithKline.